PRIMERS FOR PCR:

1. MYC:

5’ ACAGACGCCTCCCGCACGGG 3’
5’ CCACACCGAGAACGCACTGC 3’

2. UXT/ART27:

5’ GCGTCGCGCCTACCTTAGAA 3’
5’ CTCAGGCCGCCAGCAATAAG 3’

3. DHFR 3’ UTR:

5’ CTGATGTCCAGGAGGAGAAAGG 3’
5’ AGCCCGACAATGTCAAGGACTG 3’

4. COASTER:

5’ GGCGCATGGTTCTTTTCCTC 3’
5’ ACACAAACCCTTCGCGGTTC 3’

5. OIP-2:

5’ TTTCGTCGCGTCCCCACCTT 3’
5’ ATGTCTCCTGGGACTGCACG 3’

6. RBAP48:

5’ GCGGACCAAACCTCTCTCAC 3’
5’ TGTTAGGCCATGTCGAGGCC 3’

7. TA-WDRP

5’ GTTTCCATCTCCAAGGCGTC 3’
5’ CACTCACGTCATAGGTGTGG 3’

8. HP1a

5’ CGCTAACGTCTGCCCTGTTC 3’
5’ GTCAAGTCGCTTGGCAAAGC 3’

9. ZNF83:

5’ AAGACAAGGTTGGGGTCTGC 3’
5’ TACACCGTGGCGGTGAGTTT 3’

10. BRCA1:

5’ GATTGGGACCTCTTCTTACG 3’
5’ TACCCAGAGCAGAGGGTGAA 3’

11. DDX11:

5’ GGGCATTAGAACATCGGCTG 3’
5’ GAAAGGCTGCCGGAACAACC 3’

12. SPAG7:

5’ GGTGGTGTACATAGGAACGC 3’
5’ CGTCTTAAAGGGAAGGGCGG 3’

13. MCM3:

5’ CCGGAAAGGAGGGAGAACAC 3’
5’ GCCCGCTGCCAAAGAACTAC 3’

14. CTIP:

5’ CGGAGGCGGTGAGTAAAAGC 3’
5’ TTCCAGCCAGGTCCCTTCTC 3’

15. PIR51:

5’ TTCTCAGTCCAAGTGCCCCT 3’
5’ GGTCCCTTTCAAGGCTTGGT 3’

16. HTF6:

5’ AAGCTGACCCAGGGAAGGAA 3’
5’ CAGGATGTCCGGGCATCTTA 3’

17. CHEK2:

5’ GTTCTTCTGCCCACAGTGCC 3’
5’ TCCTCTAACTTCAGCGCCCG 3’

PRIMERS FOR RT_PCR

1. RT_GAPDH:

5' TGGCCAAGGTCATCCATGAC 3'
5' ATGTAGGCCATGAGGTCCAC 3'

2. RT_MYC:

5’ CCTTGCCGCATCCACGAAAC 3’
5’ GGTGGGCAGCAGCTCGAATT 3’

3. RT_E2F6:

5’ AGGATTGTGCTCAGCAGCTG 3’
5’ TCAGGGCCTTCTGGATGAGT 3’

4. RT UXT/ART27:

5’ ATCAGTGACGTGCTGCAGCG 3’
5’ TCTGCCAGTGTCAACTCCAG 3’

5. RT RBAP48:

5’ CACTGCTGAAGTGAACTGCC 3’
5’ CCTTCTGGATCCACGCTTCC 3’

6. RT HP1a:

5’ GACCTGGTGGCCTTAGTCTT 3’
5’ TCTGGTTCCAGTCCTCTCTC 3’

7. RT CTIP:

5’ GAAGCAAGAGCAGAAGGGAG 3’
5’ GGAATGTAGCGGAATCGGTG 3’

8. RT-BRCA1

5’ GGTGTCCACCCAATTGTGGT 3’
5’ GCCCTAAGCCAACAACAGCC 3’