Primers for Eberhardy, S.E. and Farnham, P.J., 2001

 

 

Gene 5' Primer 3' Primer
Mouse cad promoter tgactagcggtaccggggttgctgctgtggaacc cgggcttgcttacccaccttccccagcagtcgacac
Human cad promoter atcccgtggctccgcggac gcaaactccactggaaccac
cad coding (mouse and human) cgggatccggtcagttcatcctcactcccc cggaattcggatgtacatgccgttctcagc
-81/+26 cadluc catggtcccgccccttacgt ggcgtcttccattttaccaacagtaccgg
mouse nucleolin cacgtgctctggtgcgcg cacgtggagtcaccacgc
human b-myb ggtgttcgctatgtgggata ctcctcgctcgcaggaactg
human polII agaggcggtgggattaaaga tcctgaacggcagaggttac

 

 

[Excel]